1. Introduction
1. Introduction
With DNA from Chlamydia trachomatis (CT) and Neisseria gonorrhoeae (NG) conducted in the previous experiment, two DNA amplified simultaneously in one experiment through a *Multiplex PCR test.
*What is Multiplex PCR? Multiplex means the technique for detecting 2-4 targets in a single sample. In the case of real-time PCR, fluorescent substances are applied to the probe differently, and in the case of conventional PCR, the amplification product is applied differently.
Use of Multiplex PCR: Multiplex PCR is useful when there are a large number of detectable genes in the same sample, and a single test cab determines multiple pathogens and genotypes, saving time and money. It is used to determine STD diagnostic kits, HPV infections, and genotypes that can detect Multiple sexually transmitted microorganisms with a single examination, and whether tuberculosis is infected and or drug resistance. It is also used in forensic science and paternity test using STR markers, etc.
2. Materials and equipment
2. Materials and equipment
Materials
TaqMan Gene expression master mix, CT&NG Primer set (Forward, Reverse), Probe, CT DNA, NG DNA, dH2O
CT_F: GCGGGCGATTTGCCTTA
CT_R: CGGTCAACGAAGAGGTTTTGTC
NG_F: CCTTTGGTCTTGGTTTCCAACA
NG_R: TCATAGCGATATGGAGCGTCAA
CT_P: CGGAGCGAGTTACG-*FAM
NG_P: CTCTGCTTCGGCTCT-*HEX
*Real-time PCR is method of measuring fluorescence values of various wavelengths in real time and presenting results. Multiplex PCR is based on the range of wavelengths and fluorescence is determined by the type and attached to the probe of each target.
Wavelengths example:
| Filter | Absorption wavelength | Emission wavelength | Fluorescence
|
|---|
| 1 | 490nm | 520nm | FAM, SYBR Green Ⅰ |
| 2 | 520nm | 550nm |
|
| 3 | 550nm | 580nm |
|
| 4 | 580nm | 610nm |
|
| 5 | 630nm | 680nm |
|
Equipment
Real time PCR Machine (QuantStudio5, ABI, Thermo Fisher Scientific, USA)
3. Procedure
3. Procedure
① Prepare CT & NG DNA 10 times diluted.
| Sample 1 | Sample 2 | Sample 3 | Sample 4 | Sample 5 |
|---|
| DNA CT/NG | 2uL | 2uL of DNA Sol. from Sample 1
| 2uL of DNA Sol. from Sample 2
| 2uL of DNA Sol. from Sample 3
| 2uL of DNA Sol. from Sample 4
|
dH2O
| 16uL | 18uL | 18uL | 18uL | 18uL |
| Total | 20uL | 20uL
| 20uL
| 20uL
| 20uL
|
② Composition of PCR sample reagents.
| Sample 1~5 | NC |
|---|
| Master Mix | 10uL | 10uL
|
| Primer Set | 5uL | 5uL
|
| CT & NG DNA | 3uL | - |
dH2O
| 2uL | 5uL |
| Total | 20uL | 20uL
|
③ Set up the device according to the PCR conditions.
| Steps | Temperature | Time (min) | Cycles |
|---|
Early denaturation
| 50℃
| 02:00 | 1 |
Denaturation
| 95℃ | 10:00 | 1 |
Annealing
| 95℃ | 00:15 | 40 |
Extension
| 60℃ | 01:00 |
④ Check the graph after PCR.
4. Results
4. Results

5. Precautions
5. Precautions
① Because there are multiple targets and use corresponding fluorescence, this test (or We) should design probes so that they do not affect each other ‘s fluorescence wavelengths.
② Real time PCR instruments should select the right fluorescence for each target to enable fluorescence during experiment to avoid mistakes.
#Multiplex PCR #FAM #HEX

Contents
1.Introduction
2.Materials and equipment
3. Procedure
4. Results
5. Precautions
1. Introduction
1. Introduction
With DNA from Chlamydia trachomatis (CT) and Neisseria gonorrhoeae (NG) conducted in the previous experiment, two DNA amplified simultaneously in one experiment through a *Multiplex PCR test.
*What is Multiplex PCR? Multiplex means the technique for detecting 2-4 targets in a single sample. In the case of real-time PCR, fluorescent substances are applied to the probe differently, and in the case of conventional PCR, the amplification product is applied differently.
Use of Multiplex PCR: Multiplex PCR is useful when there are a large number of detectable genes in the same sample, and a single test cab determines multiple pathogens and genotypes, saving time and money. It is used to determine STD diagnostic kits, HPV infections, and genotypes that can detect Multiple sexually transmitted microorganisms with a single examination, and whether tuberculosis is infected and or drug resistance. It is also used in forensic science and paternity test using STR markers, etc.
2. Materials and equipment
2. Materials and equipment
Materials
TaqMan Gene expression master mix, CT&NG Primer set (Forward, Reverse), Probe, CT DNA, NG DNA, dH2O
CT_F: GCGGGCGATTTGCCTTA
CT_R: CGGTCAACGAAGAGGTTTTGTC
NG_F: CCTTTGGTCTTGGTTTCCAACA
NG_R: TCATAGCGATATGGAGCGTCAA
CT_P: CGGAGCGAGTTACG-*FAM
NG_P: CTCTGCTTCGGCTCT-*HEX
*Real-time PCR is method of measuring fluorescence values of various wavelengths in real time and presenting results. Multiplex PCR is based on the range of wavelengths and fluorescence is determined by the type and attached to the probe of each target.
Wavelengths example:
Equipment
Real time PCR Machine (QuantStudio5, ABI, Thermo Fisher Scientific, USA)
3. Procedure
3. Procedure
① Prepare CT & NG DNA 10 times diluted.
from Sample 1
from Sample 2
from Sample 3
from Sample 4
② Composition of PCR sample reagents.
③ Set up the device according to the PCR conditions.
④ Check the graph after PCR.
4. Results
4. Results
5. Precautions
5. Precautions
① Because there are multiple targets and use corresponding fluorescence, this test (or We) should design probes so that they do not affect each other ‘s fluorescence wavelengths.
② Real time PCR instruments should select the right fluorescence for each target to enable fluorescence during experiment to avoid mistakes.
#Multiplex PCR #FAM #HEX